10:54 - 30/11/2020

COVID19 – Απόδειξη παγκόσμιας απάτης ισχυρίζονται Ισπανοί επιστήμονες

Αν και ολόκληρος ο κόσμος βασίζεται στα RT-PCR τέστ για να »διαγνώσει» τη λοίμωξη Sars-Cov-2, η επιστήμη είναι ξεκάθαρη: δεν είναι κατάλληλα για αυτό το σκοπό

Torsten Engelbrecht and Konstantin Demeter

H COVID 19 και οι επακόλουθες κυβερνητικές απαντήσεις φαίνεται να αποτελούν μέρος μιας διεθνούς συνωμοσίας για διάπραξη απάτης.

Φαίνεται ότι δεν υπάρχουν ενδείξεις ότι ένας ιός που ονομάζεται SARS-CoV-2 προκαλεί μια ασθένεια που ονομάζεται COVID 19.

Μερικές φορές πρέπει να ακούσεις την διαίσθηση. Δεν είμαι ειδικός στη γενετική και, όπως πάντα, περιμἐνω την διόρθωση.

Ωστόσο, μου τράβηξε την προσοχή κάποια έρευνα που δημοσιεύτηκε από το ισπανικό ιατρικό περιοδικό D-Salud-Discovery. Η συμβουλευτική τους επιτροπή με εξαιρετικά καταρτισμένους γιατρούς και επιστήμονες προσδίδει μεγαλύτερη αξιοπιστία στην έρευνά τους.Ο ισχυρισμός τους είναι εκπληκτικός.

Οι γενετικοί εκκινητές και οι ανιχνευτές που χρησιμοποιούνται σε δοκιμές RT-PCR για τον προσδιορισμό του SARS-CoV-2 δεν στοχεύουν σε τίποτα συγκεκριμένο.

Ακολούθησα τις τεχνικές αναζήτησης που περιγράφονται σε αυτήν την αγγλική μετάφραση της έκθεσής τους και μπορώ να επιβεβαιώσω την ακρίβεια των ισχυρισμών τους σχετικά με τις αλληλουχίες νουκλεοτιδίων που αναφέρονται στα πρωτόκολλα του Παγκόσμιου Οργανισμού Υγείας. Μπορείτε να κάνετε και εσείς το ίδιο.

Το D-Salud-Discovery περιγράφει δεν υπάρχουν δοκιμές ικανές να αναγνωρίσουν το SARS-CoV-2. Κατά συνέπεια, όλοι οι ισχυρισμοί σχετικά με τον υποτιθέμενο αντίκτυπο της COVID 19 στην υγεία του πληθυσμού είναι αβάσιμοι.
Ολόκληρη η επίσημη αφήγηση COVID 19 είναι μια απάτη. Κατά τα φαινόμενα, δεν υπάρχει επιστημονική βάση για κανένα μέρος της.

Εάν αυτοί οι ισχυρισμοί είναι ακριβείς, μπορούμε να δηλώσουμε ότι δεν υπάρχουν ενδείξεις πανδημίας, απλώς έχουμε την ψευδαίσθηση μιας πανδημίας.

Έχουμε υποστεί ανυπολόγιστη απώλεια χωρίς προφανή λόγο, εκτός από τις φιλοδοξίες των αδίστακτων δεσπότων που επιθυμούν να μεταμορφώσουν την παγκόσμια οικονομία και την κοινωνία μας για να ταιριάζουν στους σκοπούς τους.
Με αυτόν τον τρόπο αυτή η »τάξη των παρασίτων» έχει ενδεχομένως διαπράξει αμέτρητα εγκλήματα. Αυτά τα εγκλήματα μπορούν και πρέπει να διερευνηθούν και να διωχθούν από το δικαστήριο.

ΠΡΟΣΔΙΟΡΙΣΜΟΣ ΠΟΙΟΥ ΠΡΑΓΜΑΤΟΣ ΑΚΡΙΒΩΣ;

Ο Παγκόσμιος Οργανισμός Υγείας (WHO) ταξινόμησε την COVID-19 (COronaVIrus Disease 2019). Κηρύσσουν παγκόσμια πανδημία COVID 19 στις 11 Μαρτίου 2019.

Οι οδηγίες των Εργαστηριακών δοκιμών του ΠΟΥ αναφέρουν:

»Ο αιτιολογικός παράγοντας [αιτία της νόσου] υπεύθυνος για την ομάδα περιπτώσεων πνευμονίας στο Wuhan έχει αναγνωριστεί ως ένας νέος ιός betacoronavirus, (στην ίδια οικογένεια με SARS-CoV και MERS-CoV) μέσω της αλληλουχίας επόμενης γενιάς (NGS) από καλλιεργημένο ιό ή απευθείας από δείγματα που ελήφθησαν από αρκετούς ασθενείς με πνευμονία. «

Ο ισχυρισμός του ΠΟΥ είναι ότι ο ιός SARS-CoV-2 προκαλεί την ασθένεια COVID-19. Ισχυρίζονται επίσης ότι ο ιός έχει αναγνωριστεί ξεκάθαρα από ερευνητές στο Wuhan.

Στην αναφορά του WHO’s Novel Coronavirus 2019-nCov Situation Report 1, αναφέρουν:

Οι κινεζικές αρχές εντόπισαν έναν νέο τύπο κοροναϊού, ο οποίος απομονώθηκε στις 7 Ιανουαρίου 2020 …… Στις 12 Ιανουαρίου 2020, η Κίνα μοιράστηκε τη γενετική ακολουθία του νέου κορανοϊού για χώρες που θα χρησιμοποιήσουν στην ανάπτυξη συγκεκριμένων διαγνωστικών συσκευών.”

Αυτές οι δύο δηλώσεις του ΠΟΥ υποδηλώνουν σαφώς ότι ο ιός SARS-CoV-2 απομονώθηκε (που σημαίνει καθαρισμένος για μελέτη) και στη συνέχεια εντοπίστηκαν γενετικές αλληλουχίες από το απομονωμένο δείγμα. Από αυτό, αναπτύχθηκαν διαγνωστικά κιτ και διανεμήθηκαν παγκοσμίως για τον έλεγχο του ιού σε χώρες, πόλεις και κοινότητες σε όλο τον κόσμο. Σύμφωνα με τον ΠΟΥ και τους Κινέζους ερευνητές, αυτές οι δοκιμές θα βρουν τον ιό που προκαλεί την COVID 19.

Ωστόσο, ο ΠΟΥ δηλώνει επίσης:

Δουλεύοντας απευθείας από τις πληροφορίες της αλληλουχίας, η ομάδα ανέπτυξε μια σειρά προσδιορισμών γενετικής ενίσχυσης (PCR) που χρησιμοποιούνται από εργαστήρια.”

Οι επιστήμονες του Wuhan ανέπτυξαν τους προσδιορισμούς γενετικής ενίσχυσης από «πληροφορίες αλληλουχίας» επειδή δεν υπήρχε απομονωμένο, καθαρισμένο δείγμα του λεγόμενου ιού SARS-CoV-2. Έδειξαν επίσης εικόνες ηλεκτρονικού μικροσκοπίου των πρόσφατα ανακαλυφθέντων βιριόντων (η σφαιρική ακίδα πρωτεΐνης που περιέχει το ιικό RNA.)

Ωστόσο, τέτοιες πρωτεϊνικές δομές δεν είναι δεν είναι μοναδικές. Μοιάζουν με άλλα στρογγυλά κυστίδια, όπως τα ενδοκυτταρικά κυστίδια και τα εξωσώματα.

Οι ιολόγοι ισχυρίζονται ότι δεν είναι δυνατόν να »απομονωθεί» ένας ιός επειδή αντιγράφεται μόνο μέσα στα κύτταρα των ξενιστών. Προσθέτουν ότι τα αξιώματα του Κoch’s δεν ισχύουν επειδή σχετίζονται με βακτήρια (που είναι ζωντανοί οργανισμοί). Αντ ‘αυτού, οι ιολόγοι παρατηρούν τα κυτταροπαθογόνα αποτελέσματα του ιού (CPE), προκαλώντας κυτταρική καλλιέργεια και μετάλλαξη και υποβάθμιση.

Όταν οι Κινέζοι ερευνητές ταξινόμησαν για πρώτη φορά ολόκληρο το γονιδίωμα του SARS-CoV-2 παρατήρησαν CPE κυτταροπαθογόνα αποτελέσματα σε κύτταρα Vero E6 και Huh7. Το Vero E6 είναι μια αθάνατη κυτταρική σειρά πιθήκου και το Huh7 είναι αθάνατα καρκινικά (καρκινικά) κύτταρα. Δηλαδή διατηρούνται in vitro (σε καλλιέργειες τρυβλίων Petri) για πολλά χρόνια.

Κεντρικό στοιχείο της επίσημης ιστορίας SARS-CoV-2 είναι η ιδέα ότι πρόκειται για ζωονοσογόνο ιό, ικανό να γεφυρώσει το χάσμα ειδών από ζώα σε ανθρώπους. Όταν επιστήμονες απο το CDC των ΗΠΑ «μόλυνανν» διάφορα κύτταρα με τον νέο ιό, σημείωσαν τα εξής:

Εξετάσαμε την ικανότητα του SARS-CoV-2 να μολύνει και να αναπαραχθεί σε αρκετά κοινές πρωτεύωντες και ανθρώπινες κυτταρικές σειρές, συμπεριλαμβανομένων των κυττάρων ανθρώπινου αδενοκαρκινώματος (A549) [πνευμονικά κύτταρα], ανθρώπινων ηπατικών κυττάρων (HUH7.0) και ανθρώπινων εμβρυϊκών νεφρικών κυττάρων ( HEK-293T), επιπρόσθετα σε Vero E6 και Vero CCL81 [κύτταρα πιθήκου]… Δεν παρατηρήθηκε κυτταροπαθητικό αποτέλεσμα σε καμία από τις κυτταρικές σειρές εκτός από τα κύτταρα Vero [κύτταρα πιθήκου]… Τα κύτταρα HUH7.0 και 293T παρουσίασαν μόνο μέτριο ιικό πολλαπλασιασμό και τα κύτταρα Α549 [ανθρώπινα κύτταρα ιστού πνεύμονα] ήταν ασύμβατα με τη μόλυνση SARS-CoV-2.”

Το CDC δεν παρατήρησε κανένα CPE κυτταροπαθογόνο αποτελέσματα στα ανθρώπινα κύτταρα. Δεν είδαν αποδείξεις ότι αυτός ο φερόμενος ιός προκάλεσε οποιαδήποτε ανθρώπινη ασθένεια. Επίσης αυτός ο υποτιθέμενος ανθρώπινος ιός δεν παρουσίασε αξιοσημείωτη αντιγραφή στα ανθρώπινα κύτταρα, υποδηλώνοντας ότι η ανθρώπινη μόλυνση από άνθρωπο θα ήταν αδύνατη.

Σημειώνοντας αυτό το πρόβλημα, μια ομάδα Πολωνών επιστημόνων εισήγαγε αυτήν την αλληλουχία τον “ιού” σε κύτταρα ανθρώπινου επιθήλιου (αναπνευστικά) κύτταρα. Παρατήρησαν τα αποτελέσματα σε αυτές τις καλλιέργειες HAE για 5 ημέρες. Σημείωσαν πολύ μεγαλύτερη αναπαραγωγή από τους επιστήμονες του CDC, αλλά τελικά δήλωσαν:

«Δεν παρατηρήσαμε καμία απελευθέρωση του ιού από τη βασική πλευρά της καλλιέργειας HAE”

Αυτό σημαίνει ότι δεν είδαν καμία ένδειξη ότι τα υποτιθέμενα βιριόνια παραβίαζαν τη μεμβράνη του κυτταρικού τοιχώματος. Και πάλι, αυτό σημαίνει ότι ο αναφερόμενος ιός δεν είναι μολυσματικός για τους ανθρώπους.

Δεν είναι σαφές ότι ο SARS-CoV-2 είναι ένας ανθρώπινος ιός ικανός να προκαλέσει ασθένεια. Μπορεί να μην υπάρχει καν φυσικά. Μπορεί να μην είναι τίποτα περισσότερο από μια ιδέα που βασίζεται σε προγνωστικές γενετικές αλληλουχίες;

ΤΟ ΤΑΞΙΔΙ ΤΗΣ ΑΝΑΚΑΛΥΨΗΣ

Το Κέντρο Ελέγχου και Πρόληψης Νοσημάτων του Wuhan και το Κλινικό Κέντρο Δημόσιας Υγείας της Σαγκάης δημοσίευσαν το πρώτο πλήρες γονιδίωμα τουSARS-CoV-2 genome (MN908947.1 ). Αυτό έχει ενημερωθεί πολλές φορές. Ωστόσο, το ΜΝ908947.1 ήταν η πρώτη γενετική αλληλουχία που περιγράφει τον υποτιθέμενο αιτιολογικό παράγοντα COVID 19 (SARS-CoV-2).

Όλες οι επακόλουθες αξιώσεις, δοκιμές, θεραπείες, στατιστικές, ανάπτυξη εμβολίων και πολιτικές που προκύπτουν βασίζονται σε αυτήν την ακολουθία. Εάν οι δοκιμές για αυτόν τον νέο ιό δεν εντοπίσουν τίποτα ικανό να προκαλέσει ασθένεια στους ανθρώπους, ολόκληρη η αφήγηση της COVID 19 δεν είναι τίποτα άλλο από μια παντομίμα.

Οι ερευνητές του WUHAN δήλωσαν δήλωσαν ότι είχαν συνενώσει αποτελεσματικά τη γενετική αλληλουχία SARS-CoV-2 συνδυάζοντας θραύσματα που βρέθηκαν σε δείγματα με άλλες, προηγουμένως ανακαλυφθείσες, γενετικές αλληλουχίες. Από το συγκεντρωμένο υλικό βρήκαν 87,1% αντιστοιχία με το SARS coronavirus (SARS-Cov). Χρησιμοποίησαν συναρμολόγηση de novo assembly and κατεύθυναν την PCR και βρήκαν 29,891-ζεύγη βάσεων που ήταν κοινά με την αντιστοιχία ακολουθίας κατά 79,6% με τον SARS-CoV.

Έπρεπε να χρησιμοποιήσουν τη de novo συναρμολόγηση επειδή δεν είχαν εκ των προτέρων γνώση της σωστής ακολουθίας ή την σειρά αυτών των θραυσμάτων. Με απλά λόγια, η δήλωση του ΠΟΥ ότι Κινέζοι ερευνητές απομόνωσαν τον ιό στις 7 Ιανουαρίου είναι λανθασμένη.

Η ομάδα του Wuhan χρησιμοποίησε 40 κύκλους ενίσχυσης RT-qPCR για να ταιριάξει τα θραύσματα του cDNA (συμπληρωματικό DNA κατασκευασμένο από θραύσματα RNA δειγματοληψίας) με το δημοσιευμένο γονιδίωμα κορονοϊού SARS (SARS-CoV). Δυστυχώς, δεν είναι σαφές πόσο ακριβές είναι και το αρχικό γονιδίωμα SARS-CoV.

Το 2003 μια ομάδα ερευνητών απο το Hong Kong μελέτησε 50 ασθενείς με σοβαρό οξύ αναπνευστικό σύνδρομο (SARS). Πήραν δείγματα από 2 από αυτούς τους ασθενείς και ανέπτυξαν καλλιέργεια σε εμβρυικά ηπατικά κύτταρα πιθήκου.

Δημιούργησαν 30 κλώνους του γενετικού υλικού που βρήκαν. Δεν ήταν δυνατή η εύρεση ενδείξεων για οποιοδήποτε άλλο γνωστό ιό, σε ένα μόνο από αυτά τα κλωνοποιημένα δείγματα βρήκαν γενετικές αλληλουχίες »άγνωστης προέλευσης».

Εξετάζοντας αυτές τις άγνωστες αλληλουχίες RNA διαπίστωσαν ότι το 57% ταιριάζει με τον κορονοιό των βοοειδών και τον ιό της ηπατίτιδας των ποντικών και συμπέραναν ότι ανήκει στην οικογένεια Coronaviridae. Λαμβάνοντας υπόψη αυτές τις ακολουθίες που υποδηλώνουν έναν πρόσφατα ανακαλυφθέντα ιό SARS-CoV (οι νέες ανακαλύψεις είναι αμβροσία για επιστήμονες), σχεδίασαν εκκινητές RT-PCR για να δοκιμάσουν αυτόν τον νέο ιό. Οι ερευνητές δήλωσαν:

Οι εκκινητές για την ανίχνευση του νέου ιού σχεδιάστηκαν για την ανίχνευση RT-PCR αυτού του γονιδιώματος κοροναϊού που σχετίζεται με την ανθρώπινη πνευμονία σε κλινικά δείγματα. Από τα 44 ρινοφαρυγγικά δείγματα που διατέθηκαν από τους 50 ασθενείς με SARS, 22 είχαν ενδείξεις RNA κοροναϊού που σχετίζεται με ανθρώπινη πνευμονία. »

Οι μισοί από τους εξετασθέντες ασθενείς, οι οποίοι είχαν όλοι τα ίδια συμπτώματα, ήταν θετικοί για αυτόν τον νέο φερόμενο ιό. Κανείς δεν ξέρει γιατί τα άλλα μισά ήταν αρνητικά για αυτόν τον νέο ιό SARS-CoV. Η ερώτηση δεν τέθηκε..

Αυτός ο υποτιθέμενος ιός είχε μια αντιστοίχιση ακολουθίας 57% με φερόμενους γνωστούς κοροναϊούς. Το άλλο 43% ήταν απλά »εκεί». Η αλληλουχία δεδομένων παράχθηκαν και καταγράφηκαν ως νέο γονιδίωμα ως GenBank Accession No. AY274119.

Οι ερευνητές του Wuhan στη συνέχεια βρήκαν μια αντιστοίχιση ακολουθίας 79,6% με το AY274119 (που αναφέραμε παραπάνω τον SARS-CoV ) και ως εκ τούτου το ονόμασαν ένα νέο στέλεχος του SARS-CoV (2019-nCoV – τελικά μετονομάστηκε SARS-CoV-2). Κανένας, σε οποιοδήποτε στάδιο αυτής της διαδικασίας, δεν είχε παράγει απομονωμένο, καθαρισμένο δείγμα οποιουδήποτε ιού. Το μόνο που είχαν ήταν αντιστοιχίες ποσοστού γενετικών ακολουθιών που ταίριαζαν με ποσοστά άλλων γενετικών ακολουθιών

ΚΑΜΙΑ ΑΠΟΜΟΝΩΣΗ

Οι επιστήμονες είναι πολύ ενοχλημένοι επειδή συνεχίζουν να λένε ότι ο ιός έχει απομονωθεί, αλλά κανείς δεν τους πιστεύει. Αυτό συμβαίνει επειδή, μέχρι στιγμής, κανείς δεν έχει παράσχει ένα καθαρό δείγμα του ιού SARS-CoV-2. Αυτό που έχουμε αντί αυτού είναι ένα ολοκληρωμένο γονιδίωμα και, όπως πρόκειται να ανακαλύψουμε, δεν είναι ιδιαίτερα πιστευτό

Οι ερευνητές δημοσιογράφοι Torsten Engelbrecht και Konstantin Demeter ρώτησαν μερικούς από τους επιστήμονες που δήλωσαν ότι είχαν εικόνες SARS-C0V-2 βιριόντων για να επιβεβαιώσουν ότι ήταν εικόνες ενός απομονωμένου, καθαρισμένου ιού. Κανείς δεν μπόρεσε να το επιβεβαιώσει.

Στην Αυστραλία επιστήμονες από το Doherty Institute, ανακοίνωσαν ότι είχαν απομονώσει τον SARS-CoV-2 virus.

Οταν τους ζητήθηκε να το διευκρινίσουν απάντησαν:

“Έχουμε μικρές (RNA) αλληλουχίες από το διαγνωστικό τεστ που μπορούν να χρησιμοποιηθούν στις διαγνωστικές δοκιμές”

Αυτό εξηγεί γιατί η κυβέρνηση της Αυστραλίας δηλώνει:

Η αξιοπιστία των δοκιμών COVID-19 είναι αβέβαιη λόγω της περιορισμένης βάσης αποδεικτικών στοιχείων … Υπάρχουν διαθέσιμα περιορισμένα στοιχεία για την αξιολόγηση της ακρίβειας και της κλινικής χρησιμότητας των διαθέσιμων δοκιμών COVID-19. ”

Στο Ηνωμένο Βασίλειο, τον Ιούλιο, μια ομάδα ενδιαφερόμενων ακαδημαϊκών έγραψε μια επιστολή στον πρωθυπουργό του Ηνωμένου Βασιλείου Μπόρις Τζόνσον στην οποία του ζήτησαν:

Δημιουργήστε ανεξάρτητα επιστημονικά αποδεικτικά στοιχεία που αποδεικνύουν ότι ο ιός Covid-19 έχει απομονωθεί. ”

Μέχρι σήμερα δεν έχουν λάβει απάντηση.

Ομοίως, ο βρετανός ερευνητής Andrew Johnson υπέβαλε ένα αίτημα παροχής πληροφοριών στη δημόσια υγεία Αγγλία (PHE). Τους ζήτησε να του παράσχουν τα αρχεία τους που περιγράφουν την απομόνωση ενός ιού SARS-COV-2. Στην οποία απάντησαν:

Το PHE μπορεί να επιβεβαιώσει ότι δεν διατηρεί πληροφορίες με τον τρόπο που προτείνει το αίτημά σας.”

Η Καναδή ερευνήτρια Massey έκανε παρόμοιο αίτημα ελευθερίας πληροφόρησης, ζητώντας από την Καναδική κυβέρνηση το ίδιο. Στην οποία η Καναδική κυβέρνηση απάντησε:

Έχοντας ολοκληρώσει μια διεξοδική αναζήτηση, λυπούμαστε που σας ενημερώνουμε ότι δεν μπορέσαμε να εντοπίσουμε αρχεία που να ανταποκρίνονται στο αίτημά σας.”

Στις ΗΠΑ το Διαγνωστικό Κέντρο Ελέγχου Νοσημάτων (CDC) RT-PCR Diagnostic Panel state:

…Δεν υπάρχει επι του παρόντος ποσοτική απομόνωση του ιού 2019-nCoV ……. Η ανίχνευση ιικού RNA ενδέχεται να μην υποδηλώνει την παρουσία μολυσματικού ιού ή ότι ο 2019-nCoV είναι ο αιτιολογικός παράγοντας για κλινικά συμπτώματα.”

Τελευταία ενημέρωση στις 13 Ιουλίου 2020, το CDC δεν έχει λάβει ακόμη καθαρό ιικό δείγμα από οποιονδήποτε ασθενή που λέγεται ότι έχει τη νόσο του COVID-19. Παραδέχονται ανοιχτά ότι οι δοκιμές τους δεν δείχνουν απαραίτητα εάν υπάρχει SARS-CoV-2 ή προκαλεί COVID 19.

Μας λένε ότι κανένα από αυτά δεν έχει σημασία. Ότι είμαστε αδαείς και απλά δεν καταλαβαίνουμε την ιολογία. Επομένως, πρέπει να αποδεχτούμε εικόνες από πράγματα που γνωρίζουμε ότι θα μπορούσαν να είναι κάτι άλλο και οι γενετικές ακολουθίες (που θα μπορούσαν να είναι οτιδήποτε άλλο) ως απόδειξη ότι αυτός ο ιός και η ασθένεια που υποτίθεται ότι προκαλούν είναι πραγματικές.

ΔIAΓΝΩΣΤΙΚΗ ΕΞΕΤΑΣΗ ΓΙΑ ΤΙΠΟΤΑ

Ο WHO, και κάθε κυβέρνηση, κάθε δεξαμένη σκέψης, κάθε συντονιστική επιτροπή πολιτικής, κάθε κυβερνητικός επιστημονικός σύμβουλος, υπερεθνικά ιδρύματα και άλλοι που προωθούν την επίσημη αφήγηση COVID 19, ισχυρίζονται ότι ο SARS-CoV-2 προκαλεί το COVID 19.

Αν και κανείς δεν έχει παράγει ποτέ δείγμα αυτού του υποτιθέμενου ιού, το φερόμενο γονιδίωμα SARS-CoV-2 έχει δημοσιευτεί. Είναι δημοσιευμένο δημόσια.

Οι βασικές γενετικές αλληλουχίες, στο γονοδίωμα SARS-CoV-2, λέγεται ότι έχουν συγκεκριμένες λειτουργίες. Αυτές είναι οι πρωτεΐνες στόχους για τις οποίες οι επιστήμονες δοκιμάζουν για να προσδιορίσουν την παρουσία του »ιού». Αυτά περιλαμβάνουν:

– RNA-πολυμεράση γονίδιο (Rd-Rp) – Αυτό επιτρέπει στο SARS-CoV-2 RNA να αντιγράφεται μέσα στο κυτταρόπλασμα των επιθηλιακών κυττάρων που έχουν νοσήσει με COVID 19.
– Γονίδιο S (Orf2) – αυτή η γλυκοπρωτεΐνη σχηματίζει την ακίδα στην επιφάνεια του βιριόντος SARS-CoV-2 η οποία υποτίθεται ότι διευκολύνει τη σύνδεση του SARS-CoV-2 με τους υποδοχείς ACE2 στα κύτταρα, επιτρέποντας στο RNA μέσα στο κέλυφος της πρωτεΐνης virion (καψίδιο) για να περάσει μέσα στο μολυσμένο κύτταρο.
– Ε γονίδιο (Orf1ab) – πρωτεΐνη μικρής μεμβράνης που χρησιμοποιείται στην ιική συναρμολόγηση
– Ν γονίδιο (Orf9a) – το γονίδιο νουκλεοκαψιδίου που δεσμεύει το RNA στο σχηματισμό καψιδίου

Ο WHO διατηρεί ένα δημόσια διαθέσιμο αρχείο των εκκινητών και των ανιχνευτών της RT-PCR που χρησιμοποιούνται για τη δοκιμή για SARS-CoV-2.

Οι εκκινητές είναι ειδικές ολιγονουκλεοτιδικές αλληλουχίες που προσδένονται (ανόπτηση) στον συνεχή και ασυνεχή κλώνο του σχηματιζόμενου cDNA (που ονομάζονται εμπρόσθιος και ανάστροφος εκκινητής αντίστοιχα.) Σε μια PCR χρησιμοποιούνται δυο εκκινητές.

Ο ένας είναι συμπληρωματικός με την περιοχή που βρίσκεται ακριβώς ανοδικά της αλληλουχίας-στόχου στoν ένα κλώνο του DNA και συχνά αναφέρεται ως ανοδικός (upstream) ή εμπρόσθιος (forward) εκκινητής. Ο άλλος είναι συμπληρωματικός με την περιοχή που βρίσκεται ακριβώς καθοδικά της αλληλουχίας στόχου στον άλλον κλώνο του DNA και συχνά αναφέρεται ως καθοδικός (downstream) ή ανάστροφος (reverse) εκκινητής, έχει την ίδια γενετική ακολουθία με το mRNA. Οι εκκινητές προσδένονται στα άκρα της αλληλουχίας-στόχου και οριοθετούν το τμήμα DNA που πρόκειται να πολλαπλασιαστεί.

Οι κλώνοι cDNA διαχωρίζονται όταν θερμαίνονται και αναμορφώνονται όταν κρυώνουν. Πριν από την ψύξη, οι νουκλεοτιδικές γενετικές αλληλουχίες που ονομάζονται εκκινητές εισάγονται για ανόπτηση σε συγκεκριμένες περιοχές στόχους του ύποπτου ιού γονιδιώματος. Κατά τη διάρκεια της ενίσχυσης, καθώς οι περιοχές μεταξύ των εκκινητών επιμηκύνονται, όταν ένας εκκινητής χτυπά έναν ανιχνευτή, ο ανιχνευτής αποσυντίθεται απελευθερώνοντας ένα φθορισμό ή μια χρωστική ουσία η οποία μπορεί στη συνέχεια να διαβαστεί από τους ερευνητές.

Είναι η αναγνώριση αυτών των δεικτών που οι επιστήμονες ισχυρίζονται ότι αποδεικνύουν την παρουσία του SARS-CoV-2 σε ένα δείγμα.

Κάτι άλλο που είναι δημόσια διαθέσιμο είναι το Βασικό εργαλείο τοπικής ευθυγράμμισης Bασικό Εργαλείο Τοπικής Ευθυγράμμισης (BLAST). Αυτό επιτρέπει σε οποιονδήποτε να συγκρίνει τις δημοσιευμένες γενετικές αλληλουχίες νουκλεοτιδίων με όλες εκείνες που αποθηκεύονται από τη γενετική βάση δεδομένων των Εθνικών Ινστιτούτων Υγείας των ΗΠΑ (NIH) που ονομάζεται GenBank. Επομένως μπορούμε να επεξεργαστούμε με το BLAST τους εκκινητές, ανιχνευτές, τις γονιδιακές αλληλουχίες στόχου του ισχυριζόμενου SARS-CoV-2.

Στα πρωτόκολλα του WHO οι εμπρόσθιοι και ανάστροφοι εκκινητές και ανιχνευτές, για το υποτιθέμενο ιικό γονιδίωμα του SARS-CoV-2, βασίζονται σε προφίλ γονιδίων των RdRp, Orf1, N and E gene profiles. Οποιοσδήποτε μπορεί να τα τρέξει μέσω του BLAST για να δει τι βρίσκουμε.

Η ζωτική αλληλουχία νουκλεοτιδίων RdRP, που χρησιμοποιείται ως εμπρόσθιος εκκινητής είναι – ATGAGCTTAGTCCTGTTG.

Εαν επεξεργαστούμε το νουκλεοτίδιο με το BLAST αυτό καταγράφεται ως πλήρης απομόνωση SARS-CoV-2 με 100% ταυτοποιημένη ταυτότητα ακολουθίας. Παρομοίως, η ανάστροφη αλληλουχία του εκκινητή γονιδίου Ε – ATATTGCAGCAGTACGCACACA – αποκαλύπτει την παρουσία της αλληλουχίας Orf1ab, η οποία επίσης αναγνωρίζεται ως SARS-CoV-2.

Ωστόσο, το BLAST μας επιτρέπει επίσης να αναζητούμε τις νουκλεοτιδικές αλληλουχίες των μικροβιακών και ανθρώπινων γονιδιωμάτων.

Εάν αναζητήσουμε την αλληλουχία RdRp SARS-CoV-2, αποκαλύπτει 99 ανθρώπινα χρωμοσώματα με ταυτοποιημένη ταυτότητα ακολουθίας. Το Orf1ab (γονίδιο Ε) επιστρέφει με 90 με αντιστοίχιση ταυτότητας ακολουθίας 100% σε ανθρώπινα χρωμοσώματα.

Κάνοντας το ίδιο για αυτές τις αλληλουχίες με μια μικροβιακή αναζήτηση βρίσκει 92 μικρόβια με 100% ταίριασμα με το γονίδιο (E) SARS-CoV-2 και 100 μικρόβια, να ταιριαἀζουν με ταυτότητα 100% ακολουθίας, με το ζωτικό γονίδιο SARS-CoV-2 RdRp.

Κάθε φορά που ελέγχουμε τους λεγόμενους μοναδικούς γενετικούς δείκτες για το SARS-CoV-2, που καταγράφονται στα πρωτόκολλα του ΠΟΥ, βρίσκουμε πλήρεις ή υψηλές ποσοστιαίες αντιστοιχίες με διάφορα θραύσματα του ανθρώπινου γονιδιώματος. Αυτό υποδηλώνει ότι οι γενετικές αλληλουχίες, οι οποίες υποτίθεται ότι αναγνωρίζουν το SARS-CoV-2, δεν είναι μοναδικές. Θα μπορούσαν να είναι οτιδήποτε από μικροβιακές αλληλουχίες έως θραύσματα ανθρώπινων χρωμοσωμάτων.

Οι επονομαζόμενοι fact checkers, όπως το Health Feedback project του Reuters, έχουν απορρίψει γρήγορα τους ισχυρισμούς εκέινων που έχουν παρατηρήσει την προφανή έλλειψη εξιδίκευσης στο υποτιθέμενο γονιδίωμα SARS-CoV-2.

Χρησιμοποιώντας μια σειρά από αβάσιμα επιχειρήματα όπως, «αυτός ο ισχυρισμός υποδηλώνει ότι κάθε τεστ θα πρέπει να είναι θετικό»” (το οποίο δεν ισχύει) η απόπειρα αποκάλυψης των λάθως ισχυρισμών παέι κάπως έτσι:

Οι εκκινητές έχουν σχεδιαστεί για να συνδέονται με συγκεκριμένες αλληλουχίες νουκλεοτιδίων που είναι μοναδικές στον ιό. Ο εμπρόσθιος εκκινητής μπορεί να συνδέεται με ένα συγκεκριμένο χρωμόσωμα αλλά ο ανάστροφος εκκινητής δεν συνδέεται με το ίδιο χρωμόσωμα και έτσι το χρωμόσωμα δεν υπάρχει στον ιό SARS-CoV-2. Επιπλέον επειδή ο εμπρόσθιος και ο ανάστροφος εκκινητής περιβάλλουν την αλληλουχία που πρόκειται να ενισχυθεί, η αλληλουχία cDMA μεταξύ εκκινητών είναι μοναδική για τον ιό.

Αυτό φαίνεται να παρερμηνεύει σκόπιμα τη σημασία αυτών των ευρημάτων προωθώντας ένα επιχείρημα που κανείς, άλλος εκτός απο τους ίδιους δεν θέτει. Οι αναζητήσεις BLAST δείχνουν ότι αυτές οι αλληλουχίες στόχου δεν είναι μοναδικές για το SARS-CoV-2. Ούτε πρέπει να βρεθούν όλοι οι στόχοι για να κριθεί θετικό ένα αποτέλεσμα.

Μαροκινοί ερευνητές διερεύνησαν την επιδημιολογία των Μαροκινών υποτιθέμενων περιπτώσεων SARS-CoV-2. Εννέα τοις εκατό ήταν θετικά για τρία γονίδια, δεκαοκτώ τοις εκατό ήταν θετικά για δύο γονίδια και εβδομήντα τρία τοις εκατό για ένα μόνο. Όπως μόλις συζητήσαμε, πολλοί μπορεί να ήταν θετικοί για κανένα.

Αυτό συνάδει πλήρως με τις οδηγίες του ΠΟΥ. Δηλώνουν:

“Η βέλτιστη διάγνωση αποτελείται από ένα NAAT [τεστ ενίσχυσης νουκλεϊκού οξέος] με τουλάχιστον δύο στόχους ανεξάρτητους από γονιδίωμα του SARS-CoV-2. Ωστόσο, σε περιοχές όπου η μετάδοση είναι ευρέως διαδεδομένη, μπορεί να χρησιμοποιηθεί ένας απλός αλγόριθμος ενός στόχου …… Ένα ή περισσότερα αρνητικά αποτελέσματα δεν αποκλείουν απαραίτητα τη μόλυνση SARS-CoV-2.”

Ανεξάρτητα από τα ψευδή επιχειρήματα των καλά χρηματοδοτούμενων ελεγκτών γεγονότων, εάν οι εμπρόσθιοι και οι α ανάστροφοι εκκινητές εντοπίζουν σκουπίδια, ίσως το ένα είναι το θραύσμα ενός χρωμοσώματος και το άλλο μια μικροβιακή ακολουθία, τότε η ενισχυμένη περιοχή μεταξύ τους είναι πιθανώς και σκουπίδια.

Το επιχείρημα ότι το RT-PCR βρίσκει μόνο το RNA είναι περίεργο. Η φυσική μεταγραφή (ο διαχωρισμός των κλώνων DNA) συμβαίνει κατά τη διάρκεια της γονιδιακής έκφρασης. Κανείς δεν λέει ότι ολόκληρα χρωμοσώματα ή μικρόβια αλληλουχίζονται στο υποτιθέμενο γονιδίωμα SARS-CoV-2. Αν και μπορεί, για όσα γνωρίζουμε. Λένε ότι οι υποτιθέμενοι δείκτες, που χρησιμοποιούνται για τη δοκιμή αυτού του υποτιθέμενου ιού, δεν είναι κατάλληλοι για το σκοπό.

Οι δοκιμές RT-PCR δεν αλληλουχούν ολόκληρο το γονιδίωμα. Αναζητούν περιστατικά ειδικού φθορισμού ανιχνευτή για να δείξουν την παρουσία ακολουθιών που λέγεται ότι υπάρχουν. Αυτές οι ακολουθίες καθορίζονται από το MN908947.1 και τις επόμενες ενημερώσεις. Αυτοί οι εκκινητές και οι ανιχνευτές δεν θα μπορούσαν να αποκαλύψουν τίποτα άλλο παρά αντιστοιχίες RNA που εξήχθησαν από μη κωδικοποιημένο, μερικές φορές αποκαλούμενες «σκουπίδια» DNA (cDNA.)

Για παράδειγμα το γονίδιο του SARS-CoV-2 S προορίζεται να είναι εξαιρετικά ειδικό για το γονιδίωμα του ιού SARS-CoV-2. Η ακολουθία στόχος είναι – TTGGCAAAATTCAAGACTCACTTTC. Μια μικροβιακή αναζήτηση BLAST επιστρέφει 97 μικρόβια να ταιριάζουν με αντιστοίχιση ακολουθίας ταυτότητας 100%. Η χαμηλότερη αντιστοίχιση ποσοστού ταυτότητας, εντός των πρώτων 100, είναι 95%. Ένα ανθρώπινο γονιδίωμα BLAST βρίσκει επίσης μια αντιστοίχιση ακολουθίας 100% με 86 θραύσματα ανθρώπινου χρωμοσώματος.

Όπου κι αν κοιτάξετε στο υποτιθέμενο γονιδίωμα του SARS-CoV-2, δεν υπάρχει τίποτα στα πρωτόκολλα δοκιμών του ΠΟΥ που να προσδιορίζει σαφώς τι είναι. Όλο το γονιδίωμα θα μπορούσε να είναι ψευδές. Οι δοκιμές δεν αποδεικνύουν την ύπαρξη του SARS-CoV-2. Το μόνο που αποκαλύπτουν είναι μια σούπα απροσδιόριστου γενετικού υλικού.

Εαν είναι έτσι, καθώς δεν υπάρχουν απομονωμένα ή καθαρισμένα δείγματα του ιού, χωρίς βιώσιμη δοκιμή, δεν υπάρχει ένδειξη ότι υπάρχει SARS-CoV-2. Επομένως, ούτε υπάρχουν ενδείξεις ότι υπάρχει νόσος που ονομάζεται COVID 19.

Αυτό σημαίνει ότι δεν υπάρχει επιστημονική βάση για τυχόν ισχυρισμούς σχετικά με τους αριθμούς περιπτώσεων COVID 19, τις εισαγωγές στο νοσοκομείο ή τα στοιχεία θνησιμότητας. Ολα τα μέτρα που λαμβάνονται για να καταπολεμήσουν αυτόν τον θανατηφόρο ιό, είναι πιθανό να βασίζονται στο τίποτα.

ΣΥΜΠΕΡΑΣΜΑ ΑΠΑΤΗΣ

Η απάτη είναι εγκληματική πράξη. Ο νομικός ορισμός definition της απάτης:

“Κάποια δόλια πρακτική ἠ σκόπιμη μέθοδος, κατευθυνόμενη με πρόθεση να στερήσει ένα άλλο από το δικαίωμά του, ή με κάποιον τρόπο να του τραυματίσει”

Ο νομικός ορισμός μιας συνωμοσίας είναι:

“Συνδυασμός ή συμμαχία μεταξύ δύο ή περισσοτέρων προσώπων που έχει δημιουργηθεί με σκοπό να διαπράξουν, με τις κοινές τους προσπάθειες, κάποια παράνομη ή εγκληματική πράξη”

Φαίνεται, όσοι ισχυρίζονται ότι αντιμετωπίζουμε πανδημία δεν έχουν παράσχει στοιχεία που να δείχνουν ότι ένας ιός που ονομάζεται SARS-CoV-2 προκαλεί μια ασθένεια που ονομάζεται COVID 19. Όλες οι πληροφορίες που υποδηλώνουν έντονα αυτή τη δυνατότητα είναι άμεσα διαθέσιμες στο δημόσιο τομέα. Ο καθένας μπορεί να τις διαβάσει.

Για να υπάρξει απάτη, η εξαπάτηση πρέπει να είναι σκόπιμη. Ο σκοπός πρέπει να είναι η σκόπιμη στέρηση από τα δικαιώματά τους τους άλλους ή ο τραυματισμός τους με κάποιον άλλο τρόπο. Εάν υπάρχουν ενδείξεις συμπαιγνίας μεταξύ ατόμων που διαφημίζουν / ή οργανισμούς για να διαπράξουν απάτη, τότε πρόκειται για συνωμοσία (στις δικαιοδοσίες του κοινού δικαίου) ή στο Joint Criminal Enterprise (JCE) βάσει του διεθνούς δικαίου.

Φαίνεται ότι η COVID 19 χρησιμοποιήθηκε σκόπιμα ως casus belli για να διεξάγει πόλεμο κατά της ανθρωπότητας. Είμαστε φυλακισμένοι στα σπίτια μας, η ελευθερία μας να περιπλανηθούμε απαγορεύτηκε, η ελευθερία του λόγου και της έκφρασης διαβρώνονται, τα δικαιώματα διαμαρτυρίας περιορίζονται, χωριζόμαστε από τους αγαπημένους, οι επιχειρήσεις μας καταστράφηκαν, βομβαρδιστήκαμε ψυχολογικά, φιμωθήκαμε με φίμωτρα και μας τρομοκράτησαν.

Ακόμα χειρότερα ενώ δεν υπάρχουν ενδείξεις για άνευ προηγουμένου θανάτων όλων των αιτιών, υπήρχαν παράλογες αιχμές στους θανάτους. Αυτοί σχετίζονται ακριβώς με τα μέτρα των Υποχρεωτικών Εγκλεισμών που οδήγησαν στην απόσυρση των υπηρεσιών υγείας για τις οποίες πληρώνουμε και στον αναπροσανατολισμό των υπηρεσιών δημόσιας υγείας για τη θεραπεία μιας φερόμενης νόσου, αποκλείοντας όλες τις άλλες.

Επιπλέον, προτείνεται από εκείνους που έχουν προωθήσει την ιστορία του COVID 19, ότι αυτή η φερόμενη ασθένεια παρέχει δικαιολογία για την πλήρη αναδιάρθρωση της παγκόσμιας οικονομίας, των πολιτικών μας συστημάτων, των κοινωνιών, των πολιτισμών και της ίδιας της ανθρωπότητας.

Για να μας επιτραπεί να συμμετάσχουμε στην επονομαζόμενη “νέα κανονικότητα” το οποίο είναι ο χονδρικός μετασχηματισμός ολόκληρης της κοινωνίας μας χωρίς τη συγκατάθεσή μας, επιμένουν να υποτασσόμαστε στους όρους τους.

Αυτά περιλαμβάνουν, αλλά δεν περιορίζονται σε, βιομετρική παρακολούθηση όλων, τον κεντρικό έλεγχο και παρακολούθηση όλων των συναλλαγών μας, καταπιεστικούς επιχειρηματικούς και κοινωνικούς περιορισμούς και μια αποτελεσματική απαίτηση ότι δεν έχουμε δικαίωμα κυριαρχίας επί των δικών μας σωμάτων. Αυτό αποτελεί την κατάσταση δουλείας.

Δεν υπάρχει αμφιβολία ότι στερηθήκαμε τα δικαιώματά μας και υποστήκαμε βλάβη. Στις δικαιοδοσίες του κοινού δικαίου τεκμαίρεται η αθωότητα, αλλά τα στοιχεία που αποδεικνύουν ότι η βλάβη προκλήθηκε σκόπιμα από μια διεθνή συνωμοσία είναι τεράστια. Καταστροφικές πολιτικές, που εφαρμόστηκαν από κυβερνήσεις σε όλο τον κόσμο, ξεκίνησαν ξεκάθαρα μεταξύ παγκοσμιοποιημένων ομάδων σκέψης και υπερεθνικών ιδρυμάτων πολύ πριν από την εμφάνιση αυτής της ανύπαρκτης πανδημίας.

Στην διακαιοδοσία του Ναπολεόντιου Κώδικα, τεκμαίρεται η ενοχή. Προκειμένου οι κατηγορούμενοι συνωμότες να αποδείξουν την αθωότητά τους, πρέπει να αποδείξουν ότι, παρά τους αμέτρητους πόρους τους, συλλογικά δεν μπόρεσαν να έχουν πρόσβαση ή να κατανοήσουν κανένα από τα ελεύθερα διαθέσιμα στοιχεία που υποδηλώνουν ότι η COVID 19 είναι μύθος.

Όσοι είναι υπεύθυνοι για το έγκλημα της συνωμοσίας για διάπραξη παγκόσμιας απάτης πρέπει να δικάζονται. Εάν κριθούν ένοχοι, θα πρέπει να φυλακιστούν ενώ οι υπόλοιποι συνεχίζουμε να προσπαθούμε να αποκαταστήσουμε τη ζημιά που έχουν ήδη προκαλέσει.

ΠΗΓΗ

COVID19 – Evidence Of Global Fraud

Καμία απόδειξη ότι το RNA του νέου κορονοιού είναι ιικής προέλευσης;

Research summary and debunk regarding the existence of «SARS-CoV-2» and «COVID-19»

fytro.wordpress.com

Loading...
Σχετικά με Κατοχικά Νέα
Η συντακτική ομάδα των κατοχικών νέων φέρνει όλη την εναλλακτική είδηση προς ξεσκαρτάρισμα απο τους ερευνητές αναγνώστες της! Έχουμε συγκεκριμένη θέση απέναντι στην υπεροντοτητα πληροφορίας και γνωρίζουμε ότι μόνο με την διαδικασία της μη δογματικής αλήθειας μπορείς να ακολουθήσεις τα χνάρια της πραγματικής αλήθειας! Εδώ λοιπόν θα βρειτε ότι θέλει το πεδίο να μας κάνει να ασχοληθούμε ...αλλά θα βρείτε και πολλούς πλέον που κατανόησαν και την πληροφορία του πεδιου την κάνουν κομματάκια! Είμαστε ομάδα έρευνας και αυτό σημαίνει ότι δεν έχουμε μαζί μας καμία ταμπέλα που θα μας απομακρύνει από το φως της αλήθειας ! Το Κατοχικά Νέα λοιπόν δεν είναι μια ειδησεογραφική σελίδα αλλά μια σελίδα έρευνας και κριτικής όλων των στοιχείων της καθημερινότητας ! Το Κατοχικά Νέα είναι ο χώρος όπου οι ελεύθεροι ερευνητές χρησιμοποιούν τον τοίχο αναδημοσιεύσεως σαν αποθήκη στοιχείων σε πολύ μεγαλύτερη έρευνα από ότι το φανερό έτσι ώστε μόνοι τους να καταλήξουν στο τι είναι αλήθεια και τι είναι ψέμα ! Χωρίς να αναγκαστούν να δεχθούν δογματικές και μασημενες αλήθειες από κανέναν άλλο πάρα μόνο από την προσωπική τους κρίση!

Σχόλια Αναγνωστών (1)

  1. κοκκινιστό με ρύζι 11/30/2020 @ 1:45 ΜΜ

    Την άνοιξη που υποτίθεται ξεκίνησε η πανδημία δεν υπήρχε καν τρόπος να διαχωρίζουν το κορωνοιό από τις γρίππες.
    Το Σεπτέμβρη του 2020 εγκρίθηκε το τεστ
    m.naftemporiki.gr/story/1633434/ipa-egkrithike-diagnostiko-test-pou-ksexorizei-ton-sars-cov-2-apo-ti-gripi-a-kai-b?fbclid=IwAR0tnYQrjuC3Yu1BhlD8O5vniKByBmA58YDHGLPEkwmQMMmKbeS_dlfyAIQ

Σχολιάστε

To e-mail σας δεν θα δημοσιευθεί


*


Μην συνεχιζεις να βοηθας της σελιδες που θελουν να σου προσφερουν προπαγανδα !

Παρακαλώ απενεργοποιήστε τον AdBlocker σας! Το να εχεις adBlocker σε ανεξαρτητες σελιδες ειναι σαν να θες αυτες οι σελιδες να σταματησουν να προσφερουν δωρεαν της υπηρεσιες τους η να κλεισουν!.. Αν μας εκτιματε σαν σελιδα σας παρακαλουμε απενεργοποιηστε τον AdBlocker σας!

How to disable? Refresh